Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST420021
Clone ID OST420021
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST420021
Sequence
TGAGCTGGTATTTAAAGATGCTGCAGTGCTGCAAATGTAAGCAGTGGTTTCATGAAGCTTGTGTCCAATGCCTTCAGAAG
CCAATGCTGTTTGGAGATAGGTTTTATACATTTATTTGCTCTGTCTGCAGTTCTGGACCAGAATACCTCAAACGTCTACC
GTTACAGTGGGTAGATATAGCACACCTATGCCTTTACAACCTAAGTGTTATTCACAAGAAGAAATACTTTGATTCTGAAC
TTGAGCTTATGACATACATTAATGAAAACTGGGATAGATTGCACCCTGGAGAGCTGGCAGACACACCCAAATCTGAAAGA
TATGAGCATGTTCTGGAGGCATTAAATGATTACAAGACCATGTTTATGTCTGGGAAAGAAATAAAGAAGAAGAAGCTTTT
GNTTGGGTTGCGAATTCGNGNTCCTCCTGTGCCACCAAATGTGGCTTTCAAAGCAGAGAAAGAACCAGAAGGAACATCCC
ATGAATTTAAAATTAAAGGCAGAAAGG
Sequence Type mRNA
Unitrap ID UNI935

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108521078..108529977 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029267 (Mtf2) NM_013827 metal response element binding transcription factor 2 Gene [Source:MGI (curated);Acc:Mtf2-001]

 
Come back to gene ENSMUSG00000029267


For any suggestions or comments, please send an email to unitrap@crg.es