Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_535H12-5S
Clone ID CMHD-GT_535H12-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_535H12-5S
Sequence
AATTTATATTTGTTTGTTCTAGTCATGTTTTAAGTGGAAATAATGCTATGTAACTTTTTTTTTGATATTTCATTTCTTTG
GATAAATACGCTCTGGTCTGTTTACTATTGCTTTTTCCCCTGTCATTGATCATGGTAGTGACAATAAGGGTATTAAAGTA
ATATAAACAGGGTTTCCAGAATTAGGTGCTTGTACATCCTGCTCTTAGTAATAAAGACAAGGTAATCCGTTTTGTTTTGT
TT
Sequence Type genomic DNA
Unitrap ID UNI37004

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74815273..74815514 228
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024069 (Slc30a6) NM_144798 solute carrier family 30 (zinc transporter), member 6 Gene [Source:MGI Symbol;Acc:MGI:2386741]

 
Come back to gene ENSMUSG00000024069


For any suggestions or comments, please send an email to unitrap@crg.es