Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_532G5-5S
Clone ID CMHD-GT_532G5-5S
Vector GepNMDi3
Project cmhd

SPLK-Sequence tag CMHD-GT_532G5-5S
Sequence
CCGAGTCAGGGTTTCTCTGTATAGCCCTGGCTGTCGTGGAACTCACTTTTTAGACCAGGCTGGCCTCGAACTCAGAAATC
CACCTGCCTCTGCCTCCCGAGTGCTGGGATTAAAGGCATGTGCCACCAGGCCCAGCTGTATACATAGATATTAAGTTCCA
CAGCAAGGGAG
Sequence Type genomic DNA
Unitrap ID UNI37005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 138428386..138428555 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078518 (OTTMUSG00000010069) predicted gene, OTTMUSG00000010069 Gene [Source:MGI Symbol;Acc:MGI:3651765]

 
Come back to gene ENSMUSG00000078518


For any suggestions or comments, please send an email to unitrap@crg.es