Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_520E12-5S
Clone ID CMHD-GT_520E12-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_520E12-5S
Sequence
GCAGGGGCAGGTGGATTTCTGAGTTCAAAGCCAGCCTGGTTTACAGAGTGAGTTTCAGGACAGCCAGGGCTATACAGATA
AATCATGTTCAAAAAAGCAACATGTGGTGGTCTCACCACCTATCTCAATCAATTCTGCCCAGGTATAGGCTGTAGAAATA
ACTTGGGGGCAAGGTCACATAGCGTCTTGTCTCTTGGGGACCTGAACTTAGCATTACACTTGAATCTAGCTTGTGTCAAG
TTGACAAGAACCTACTCCGGACAGGATATAGTGTAGTTTCCCAGCATGTGCAAGGAAGGCCCTAGGCTAGATTCTTCTCT
CTTTCTGTATTTTATTTATTTTATGTATGAGTGCTCTGTCTGCATGTACACCTGCATGCCAGAAGAGGGCATCAGATCCC
ACTATAGATGCTTGTGATCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTGAAGGAACATACAGTGTTCTTAAC
CACTGAGCCATCTCTCCAGTCCACTAGGTTACATTATCAACACTGCCAAAACAAAGATGCTTTGCCCAAGCATGGTGGCA
CATGCTTGTAACCCCCACACTAGGGAGACTGAAGTGAGGACATGGAGAGTTTAAAACCAGTCTGGGCTACATAACAAGAG
TCTGTACAAAACAAAGAAATAAAAGGGTAATGATTTGTTTTTTCAGACCTCCCAACCACATTCCAAATATTCAGTAGAAT
CACAGTCTAGCGACAGAAGATATGGAATATTTACAGGTGTTGGAGAGATGACTCAGCAGTTAC
Sequence Type genomic DNA
Unitrap ID UNI19344

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134147820..134148602 773
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030681 (Mvp) NP_542369 major vault protein Gene [Source:MGI (curated);Acc:Mvp-001]

 
Come back to gene ENSMUSG00000030681


For any suggestions or comments, please send an email to unitrap@crg.es