Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_518H12-5S
Clone ID CMHD-GT_518H12-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_518H12-5S
Sequence
AATTTTGGTAAACAGATGTAAAGAACACTTAGTAATCAGCGGTAAGAAAAACAAATCTTCCCATTTCGTTGTCGTGCTGC
AACGTTTTTGTTTTGGTGCGAGTTTATAAGTGGAAAGTACATAACTTTATAACTTGTAATACAAATCAGGCATGGTTTAA
TGCTTAGAAAATCCTGCTTATTGGTAGCTTCAACTTTTAGATATGAGGAATTAAACATGTTATGGGATGGCAACATCAAA
AACCTAGTACCTAAGGTTTAGAAATGTAAATGGATTCCCGTTGCTCCTTTTTAGTACTTCTGAACTAGGATGTAATTAAC
CAAAACGCAGAAACACAGGACACTG
Sequence Type genomic DNA
Unitrap ID UNI30072

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 132072880..132073180 295
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027341 (5730494N06Rik) NM_027478 RIKEN cDNA 5730494N06 gene Gene [Source:MGI Symbol;Acc:MGI:1917862]

 
Come back to gene ENSMUSG00000027341


For any suggestions or comments, please send an email to unitrap@crg.es