Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_518B8-5S
Clone ID CMHD-GT_518B8-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_518B8-5S
Sequence
GTTTTCTCGCCATATTTCAGGTCCTTCTGTGTGCATTTATCATTTTTCACGTTGTGTAGCGATTTCGTCATTTTTCAAGT
TGTCAAGTGGATGTTTGTCATTTTCCATGATTATCTGTTTTCTTGCGATATTATAAGTCAGACAGAGTACGTTGTGGAAT
TTAATTTGGCATTTGATCTTTGAACTTAATTTAGGAGCACTAAGAAGGAAAAATGCTGGCCATCTGCAGATTCTTGACAG
AATCTTTGGTGGTAAGGGCAGTGTCATCCTTAAAAGTCCTAGGAAAAACAGTTTTTCATTTTAAGAAGTACCCTGACTTT
AGGAAACATTAAAATCTACATTTACTAATGTGTAGCTTAAGATTCTAATGGGCAGCATGGCAGCATTTAATTTGTTGATA
TTTAAGTTTCATCTTCTGTATACACCTCAGTGTATGTGTGTGCCCTTTTGTGAGTGCATGCACCCTTGGGCATGAGAAGA
GGACATT
Sequence Type genomic DNA
Unitrap ID UNI14684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32920823..32921157 331
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]

 
Come back to gene ENSMUSG00000014932


For any suggestions or comments, please send an email to unitrap@crg.es