Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_524A2-5S
Clone ID CMHD-GT_524A2-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_524A2-5S
Sequence
AATTCAGAAGGGGGGAATTGAGAGCTGAAACAGTAAGATCCGCTCCAGGAGCAGGTTGCTCACAGTGTGCCCTTCTATTG
TTAAAGCTCACAGACATTGGCCCTTGGTCAGGATAGTTCTTTATTATGTGTTTGAGTGCATAGCCCCCATGCCTCTGCTG
CAGGTACTTGTCTGAGCATGCCATACATAGTAAGGGCAGAAACCCCTTCCAAAGACACATAACAGGAAT
Sequence Type genomic DNA
Unitrap ID UNI10020

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4972431..4972659 229
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]

 
Come back to gene ENSMUSG00000009079


For any suggestions or comments, please send an email to unitrap@crg.es