Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_542F6-3S
Clone ID CMHD-GT_542F6-3S
Vector GepNMDi3
Project cmhd

SPLK-Sequence tag CMHD-GT_542F6-3S
Sequence
GTATCTCAATGTTGGCATAATCATTGTTTTGTGAGAGAATATTGTAGACTTTCAGTGAAATGTTTGTCATCTCTCTCCCA
AACAGACCTGCTGGTGCTCACCCTTGGCCCTAGAAACCCCCTGTCCTTGGAAGGCTGGACTGCGCTCGCTCGCCCGCTCG
GGTCCAGCCATGCTTCTGAAAGCACTGGTGTTTGTCTTTGTTGCCGGTCACCACCAGTTCCACACGGAAGCTCTTGGCCT
CTCCACTTTGCTTTCTCCTGCCTCCTGTAAATT
Sequence Type genomic DNA
Unitrap ID UNI35893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93227500..93227772 273
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es