Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_536C9-3
Clone ID CMHD-GT_536C9-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_536C9-3
Sequence
GTCTAAGGAGCCTATACCCCCTACCTACATCGGTGCAATGGCACTGTCAGCCCCCTTGAGGAGCCTGGAGGAAGAGGTGA
CCTGCTCCATCTGCCTGGATTACCTGAGGGACCCGGTGACCATCGACTGTGGCCATGTCTTCTGTCGCAGCTGCACAAGT
GATATCCGCCCCATATCGGGGAACCGGCCTGTCTGCCCGCTCTGCAAGAAGCCCTTTAAGAAGGAGAACATCCGACCCGT
GTGGCAGCTAGCAAGTCTGGTGGAGAACATTGAACGGCTGAAGGTGGACAATGGCAGACAGCCAGGAGAGCTCGCCCGCG
AGCCACAGGACATGAAGTTGTGTGAGCGGCACCAGGAGAAGCTACACTACTACTGTGAAGATGATGGCAAACTGTTGTGT
GTGATGTGCAGGGAGTCCCGGGAGCACCGCCCCCACACTGCAGTCCTGGTGGAGAAAGCCGCCCTGCCTCACAAAAAAAA
AATTCAAAACCACTATGAACACCCTAAGGAGAGACAGAGACAAAATCCAGGGCTTTCAAGCCAAGGGAGAAGCTGATATT
CTGGCTGCACTGACAAAGCTGCAGGAGCAGAGGCAGTACATTGTGGCGGAATTTAAGCAGGGCCACCAGTTTCTAAAGAA
GCGGGAGCAGCACCTGCTAGACCAGCTGGCCACCTTGGAGCAGCTCCTCACCGAGGGCAGGGAGAAGTTCAAGACCCGGG
GCGTCAGTGAGCTTGACCGGTTGACTCTGGTCATCTCCGACCTGGAGGGCAAGGCACGACAGCCAGCTGCAGAGC
Sequence Type mRNA
Unitrap ID UNI23296

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36987601..36989630 451
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024457 (Trim26) NM_001025599 tripartite motif-containing 26 Gene [Source:MGI Symbol;Acc:MGI:1337056]

 
Come back to gene ENSMUSG00000024457


For any suggestions or comments, please send an email to unitrap@crg.es