Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_522D9-3
Clone ID CMHD-GT_522D9-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_522D9-3
Sequence
GCCCTCATATTTCGATGGCCCCCGACATAAAAGGATAAACGGGATGTAAACTACCGCCTGGCCAAGGAGAATGGCTGGCT
GGGCCCGAAGCGCTTTCAAGCTCCTGCAACTGGATGAGGAATTCCAACTCTTCAAAGGTGTGAAGCGAGCGGTTGACTTG
TGTGCAGCCCCAGGCAGCTGGAGCCAGGTGCTGAGCCAGAAGGTTGGGGGCCAGGGTTCTGGTCAGGTGGTGGCCGTGGA
CTTACAGGCTATGGCTCCACTGCCAGGTGTGATACAGATACAGGGCGACATCACTCAGCTTTCCACTGCCAAGGAGATCA
TCCAGCACTTTGAAGGCTGCCCTGCTGACCTAGTAGTGTGTGACGGGGCTCCTGATGTCACTGGTCTCCATGATGTGGAT
GAGTACATGCAGGCCCAGCTTCTGCTAGCTGCTCTCAACATCGCTACTCATGTCTTGAAGCTAGGGGGCTGCTTCGTGGC
CAAGATATTCCGAGGCCGGGATGTGACCCTGCTCTACAGCCAACTACGTATCTTCTTCTCCAGTGTGCTCTGCGCTAAGC
CCAAGAGCAGCCGGAACTCTAGCATTGAGGCCTTTGCTGTGTGTCAGGGTTATGACCCTCCTGAGGGCTTCATTCCAGAC
CTGACCAGACCCCTGCTGAACCACTCATATGATTTCAACCAGTTGGATGGTCCCGCCCGTGTTATTGTGCCCTTTGTGG
Sequence Type mRNA
Unitrap ID UNI37024

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7822728..7828140 107
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031171 (Ftsj1) NM_133991 FtsJ homolog 1 (E. coli) Gene [Source:MGI (curated);Acc:Ftsj1-001]

 
Come back to gene ENSMUSG00000031171


For any suggestions or comments, please send an email to unitrap@crg.es