Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_98A5-3
Clone ID CMHD-GT_98A5-3
Vector Gen-SD5
Project cmhd

Sequence tag CMHD-GT_98A5-3
Sequence
TCGGTATTTGAATGTTAGATGTCGCCCTTTTTTCTTCAAAATAAATACAAAACAAACCTCCTGGCCATAAAAACATGAAC
AAAAAAACGGTCCCCTTGTACCCGTACTGGCCCACGCCCCTGACGCTGGACAACTTCTTGCCTAATGCCCTCCGGACTTG
ACATATCCTGCTTGGCTTCTTCTCCATCTCTAGAGGAATGAATTGTGATAACGTGCCCGTTGTCTAATCGATCTTCCGTA
TGGCCCACTTGGAGCTGGGCGGCTACCGGCCTTGTGATGGTTTGCTGTGTGTACCTTCGTTCTCCTTGTGATCGATGGCT
AGTTCTCTCTCTACAATGGCTTCCTTTTATAATACCCATCCTTCTTATCCCAACTCTGGAAAGAGTATTCCGAGGGAGAT
AGCCGATATATCCTTAATGACAGCTTCGTCGTCTGTATGGAGACTGTCACAGCTTGTCTCTGGGGACCACTCAGCCTATG
GGTAGTGATTGCCTTTCTCCGCCAACAGCCCTTCCGCTTTGTCCTACAGCTTGTGGTGTCTATGGGCCAGATATACGGGG
ATGTGCTGTACTTCCTGACAGAGCTACACGAAGGACTCCAGCATGGGGGAGATAGGCCACCCCGTTTATTTCTGGTTCTA
TTTTGTTTTCCTGAATGCTGTATGGTTGGTGATACCAAGCATCCTTGTGCTTGATGCCCATAAAGCATCTTCCTAGTGCC
CAGAGCGTGCTGGGACAGCAAATTCTTGAAAATTAATAGCAAGCATAACTAAAGAGCCCGGAGAGTGGGCTGATTCCCTG
CTGATGA
Sequence Type mRNA
Unitrap ID UNI25414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7762702..7767517 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031168 (Ebp) NM_007898 phenylalkylamine Ca2+ antagonist (emopamil) binding protein Gene [Source:MGI (curated);Acc:Ebp-001]

 
Come back to gene ENSMUSG00000031168


For any suggestions or comments, please send an email to unitrap@crg.es