Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_98B8-3
Clone ID CMHD-GT_98B8-3
Vector Gen-SD5
Project cmhd

Sequence tag CMHD-GT_98B8-3
Sequence
AAAACCATGGCAGATGGGAATGAGAAGAAGTTGGAGAAAGTTAAAGCCTACCGGGAGAAGATTGAAAAGGAGCTGGAGAC
AGTTTGCAATGATGTCTTGGCTCTGCTTGACAAGTTCCTTATCAAGAACTGCAATGATTTTCAGTATGAGAGCAAGGTGT
TCTACCTGAAAATGAAGGGCGATTACTACCGCTACCTGGCAGAGGTGGCTTCTGGGGAGAAGAAAAACTGTGTGGTTGAA
GCTTCTGAGGCCGCGTATAAGGAAGCCTTCGAAATCAGCAAAGAGCACATGCAGCCAACACACCCCATCCGGCTTGGCCT
GGCCCTCAATTTTTCTGTGTTCTACTATGAGATCCAGAATGGCACCAGAGCAAGCCTGCCTCTTAGCCAAACAAGCCTTC
GATGATGCTATAGCTGAGCTGGACACATTAAACGAGGATTCCTATAAGGACTCCACTCTCATCATGCAGTTGCTGCGAGA
CAACCTCACCCTCTGGACGAGCGACCAGCAGGATGAATAAGCAGGAGAAGGCAACTGAAGACCCTTCAGGTCTCTGGCTC
TTCCTTCACCCACCACCCCCATTATCACTGATTCTTCCTTGC
Sequence Type mRNA
Unitrap ID UNI641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 33369308..33369908 592
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018965 (Ywhah) NM_011738 tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, eta polypeptide Gene [Source:MGI (curated);Acc:Ywhah-001]

 
Come back to gene ENSMUSG00000018965


For any suggestions or comments, please send an email to unitrap@crg.es