Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_193B4-3
Clone ID CMHD-GT_193B4-3
Vector pSD5*
Project cmhd

Sequence tag CMHD-GT_193B4-3
Sequence
GTGCTGAGATGAACATGATAAGGTTTGCAGAGTTCGCAACCCAGAAGGACGGAGAAGGGCAACTTTCTTGTGGGGTTTCT
AGGCAGCCCCAGCCAGAATGACAGCATCCTGCCTGGGTGGTGTAGAATGTCCATTAAATGTATCCAATGCCT
Sequence Type mRNA
Unitrap ID UNI37028

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 25089996..25090147 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075482 (Gm757) NM_001033410 gene model 757, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685603]

 
Come back to gene ENSMUSG00000075482


For any suggestions or comments, please send an email to unitrap@crg.es