Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_540D1-5S
Clone ID CMHD-GT_540D1-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_540D1-5S
Sequence
GGCGTAACAGCTTAAGGTTGAGCTGTCTCTATTTAAAGGATAAAGTGGGTGGTTGAGTAGCCTTAAAATGCCTCTTAGTA
ATTCCCTCCCCTGGCTGTTCTTGAGGTAGACCTTGGGGAGGGTGGGGTCACATAGACTGGAGATTTGAGGCAGGAGGCCC
CCACCCCCCTGGATGGCCCTGGTGGCCTGGAGCCCTTCGTTCAGGCTGCTGAGTTTGATTATAGTTGAGGTTCAGACTGA
TGCAGGACCCCTGGATGAACTGGTAGAGCCCACAGGTGTCAAACTACATACCTTGCCTCCCTGTGAACACACTCCATGTT
CCTGTTGGGGTAGGCTACATGTCTAAGAAGTGATA
Sequence Type genomic DNA
Unitrap ID UNI29874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22433453..22433807 355
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es