Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_501A3-3
Clone ID CMHD-GT_501A3-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_501A3-3
Sequence
TGGAAAATCGGAATACATTTGAACCTGCCAAACGAGCTCATGTTGTGCCGCCACCTAGAGGCCGGGGCCGGGGAGGATTT
GGACAGGGCATACGGCCCCATGATATTTTCCGTCAGAGAAAGCAGAACACGAGCAGGCCGCCATCTATGCACGTGGATGA
CTTTGTTGCAGCTGAAAGTAAAGAAGTGGTCCCTCAAGATGGAATACCCCCACCAAAACGGCCACTCAAAGTCTCACAAA
AGATTTCCTCTCGTGGTGGATTTTCAGGCAACCGAGGAGGACGGGGTGCTTTTCATAGTCAGAACAGGTTTTTCACACCG
CCTGCTTCGAAAGGAAACTACAGTCGTCGGGAAGGAACAAGAGGCTCGAGTTGGAGTGCTCAGAACACTCCTCGAGGAAA
TTATAATGAAAGCCGAGGGGGCCAGAGCAACTTTAACAGGGGTCCTCTTCCACCATTACGGCCGCTTAGTTCTACGGGTT
ACCGCCCTAGTCCCCGGGATCGAGCTTCTAGAGGCCGCGGGGGCCTGGGACCGTCCTGGGCTAGTACAAATAGCGGCAGT
GGAGGCTCGAGAGGAAAGTTTGTTAGTGGAGGCAGTGGTAGAGGCCGTCATGTACGGTCCTTTACTCGATAGATGTGTTC
TTGGCAACACCCCAAGTAAATGCACATTTCATGAGGACAAAAACAAACAGACCTTGAAGGACCAATTTAGACTTAACAGT
TATATCCTGGATACATCTGAAAGAATATTTTTATCTGAAGAAAGCAGATTTTGTTTGATAC
Sequence Type mRNA
Unitrap ID UNI37039

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 11473116..11476994 329
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040720 (1110037F02Rik) NM_001081183 RIKEN cDNA 1110037F02 gene Gene [Source:MGI Symbol;Acc:MGI:1913435]

 
Come back to gene ENSMUSG00000040720


For any suggestions or comments, please send an email to unitrap@crg.es