Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_242E1-3
Clone ID CMHD-GT_242E1-3
Vector pGTNMDf
Project cmhd

Sequence tag CMHD-GT_242E1-3
Sequence
CCCCTGATCCATCTACCCATACAGCCACCGAGTGTTTATGGGAGTCCTGGCCTTCTTCACAGCTATCGCCTTGCTGTGCC
TGGCATTTCTTCTGTATCTATGTTCATCATTCAGGACAAAGGAGCGCTCTGAGAATGCCTTCGACCAAGCAGTGGATTCT
GATTGAGCCTTCCAAGCAGCACCTGTCACCCCAGGCTGCCAGAACCCACCAGAGTGACACCACACAGTGTGAGTGAAGTG
GCTGCCACCAGGACCTGTCCCGTGCTTAAATGCCAAGGTCATGTGCCTCTCAGCCACTGATTCCTGCCAGAGCACCTCCT
GGGAGTCCCTCATCCACCCAGTGGGGACTGCCTTTGCAATCCTCCCTACCTGCTTGCTGATCCACTGGGAATCAAGGAGA
CACTGGCTGTTGGTGTCAGGGGCTTCACTCTGTCTACTCCAGAGGAAGTTGAGAATATAATTTAATGCAGAAGAATTG
Sequence Type mRNA
Unitrap ID UNI37043

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 120475495..120475971 474
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041608 (Entpd3) NM_178676 ectonucleoside triphosphate diphosphohydrolase 3 Gene [Source:MGI Symbol;Acc:MGI:1321386]

 
Come back to gene ENSMUSG00000041608


For any suggestions or comments, please send an email to unitrap@crg.es