Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_541B8-3
Clone ID CMHD-GT_541B8-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_541B8-3
Sequence
ATTGAAACAATTGGCAAAAAGGTGTCTTCCAAGAGAATTCCGTACACTCCTGGTGAGATTCCGAAGTTTAGTCTTCAGGA
CCCACCTAACAAGAAACCCAAAGTCTAGACATTGCCCTCTTACCTGGGATAACGTGGTACTTCAGGGTAGCCAGTGTCTG
TCTGATACTAAATGGTAAATGAACTACATGTTTTTAAGGAAACAAAAATATTTTTGTAATCATCAAATTTATACTAGCTA
TATGGGTATTAGCATATCCAGTAATTATGAGTCTAGAGTAATTTTTACATATTTTTATATTATTGTCCTCTCAGTTACTG
AATGAATGGAAAACAATCATGTTGTTTTAAATGTCAGTTTTTGTAAAATAAAAATGAAACCTAGACATTTTCAGCATTAC
AAATTGTCTACAGACTGCACTTTAATAATACAAGGGAAAGGCAGTCTCGTTCTCATATGTGTTGTCTGCTTATCATTCAA
TGGGACTTTGAAGCCATGAAATCACTGTGCTAGTATGGGCTGGTTAAAGTTCGCTGGCCTTTTGTTTTAATGGGATTATG
TCATTAGAGGTTTTAATTGTTTTTTTGTTTTTCCCAAGAGCTCACTCTGCATTTCCTTCCCTGCCTAACTTGAACAGTGC
TCTCTTTTTTTAAAAAAATATAACCTGAGAAGAAAAATCAACAGTATGGTCTATTTCATTTTGTTTCTTAGCTTCTGTAG
CTGCTTGTTACATTTGCATCTGTGAGTCAAGAAATGTTTGTTATCTTTGATTTTTTATTTCTATTACAATTAAATTGTTT
TTCCTTTAAGCAAACAAATAAAATCCCATGTGTAGACTG
Sequence Type mRNA
Unitrap ID UNI14034

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 65804464..65805302 839
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029201 (Ugdh) NM_009466 UDP-glucose dehydrogenase Gene [Source:MGI (curated);Acc:Ugdh-001]

 
Come back to gene ENSMUSG00000029201


For any suggestions or comments, please send an email to unitrap@crg.es