Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_541E4-3
Clone ID CMHD-GT_541E4-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_541E4-3
Sequence
GAATTTTTACGTGGTGAGAAGTGCCTGGATCAGCTAATTGAGAGATTGCTTCAATCAGCAGATGAAGAGGCCATTTCCGA
ATTTTTGGATGAAAGCCTTCAATCAGTGAAATAAATTATTTGTTATATAAATGAAGTGGACTTTGATCAAGAAAAAAAAA
GGTGTGGAAATCTTAATAAATATTCATAAAGTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACTTTGGTTGATTTTTCCC
TGCTAAAAAACGCTGAGCCATCTTGCAAGCTCCTTGCTGGCCATTTCCTATAAAGCCTCGTCCTGCTGGGAACTCAGGGT
TACCCTCCCATTTTACTGTGTCAGAGATGTTGGTGTAGCCCAAACTCAAGCTTGTAAATAAAGATCCTAGTGCAATTGC
Sequence Type mRNA
Unitrap ID UNI28731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79823204..79834992 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022022 (Mtrf1) NM_145960 mitochondrial translational release factor 1 Gene [Source:MGI Symbol;Acc:MGI:2384815]

 
Come back to gene ENSMUSG00000022022


For any suggestions or comments, please send an email to unitrap@crg.es