Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_528F8-3
Clone ID CMHD-GT_528F8-3
Vector pNMDi4
Project cmhd

Sequence tag CMHD-GT_528F8-3
Sequence
ATGAGGACTTCTTTAGCCTCATCTTACGCTCTCAAGCTAAAAGAATGGATGAGCAGAGAGTTCTGCTGCAAAGAGATCCA
AACAGAGACAGTGAGTTTGGACTAAAGGAACTTTTGCAAAATAACGATTTAGATGGAATTTAAGCATTCGGG
Sequence Type mRNA
Unitrap ID UNI37046

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 108482504..108482654 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027883 (Gpsm2) NP_083798 G-protein signalling modulator 2 (AGS3-like, C. elegans) Gene [Source:MGI (curated);Acc:Gpsm2-001]

 
Come back to gene ENSMUSG00000027883


For any suggestions or comments, please send an email to unitrap@crg.es