Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_528D4-3
Clone ID CMHD-GT_528D4-3
Vector pNMDi4
Project cmhd

Sequence tag CMHD-GT_528D4-3
Sequence
GCCTGTGATGGTAACTTGAGGTGAGAGTCGATGATGAAATGCCTCAACATGCCGTACTGTCTGGGCCAAACCTGTTCATC
AATAACCTAAACAAAACAGATAACGGTACTTACCGCTGTGAGGCTTCCAACATAGTGGGAAAGGCTCATTCGGACTATAT
GCTGTATGTATACGGTACGTGAGAAGATACAGTGCTCGCCCACTCACTCCTCTGCATGTAGCTGCTGCCTGGGCTTCACC
CCAAAGCCTTTGGTCAAGTTGAAAACC
Sequence Type mRNA
Unitrap ID UNI37049

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 47621856..47622121 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032076 (Cadm1) NM_207675 cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Cadm1-001]

 
Come back to gene ENSMUSG00000032076


For any suggestions or comments, please send an email to unitrap@crg.es