Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST419684
Clone ID OST419684
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST419684
Sequence
CACTGGTCAATCGAGCTAAGCTGCTCAATATTGGCTTTCAAGAGGCCTTGAAGGACTATGATTACAACTGCTTTGTGTTC
AGTGATGTGGACCTCATTCCGATGGACGACCGTAATGCCTACAGGTGTTTTTCGCAGCCACGGNACATTTCTGTTGCAAT
GGACAAGNTCGGGTTTAGCCTGCCATATGTCTCAGTATTTTGGAGGTGTCTNTGCTCTCAGTAAACAACAGTTTCTTGCC
ATCAATGGATTCCCTAATAATTATTGGGGTTGG
Sequence Type mRNA
Unitrap ID UNI18613

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40756741..40759892 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028413 (B4galt1) NM_022305 UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1 Gene [Source:MGI (curated);Acc:B4galt1-001]

 
Come back to gene ENSMUSG00000028413


For any suggestions or comments, please send an email to unitrap@crg.es