Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_516E1-3
Clone ID CMHD-GT_516E1-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_516E1-3
Sequence
TTGGCCAGCACATCTGAGCCAGCACATCCACATAAGTTGCCTTTTGACAGAGCTGTGGCCATGGCAGCATGGTAGGATCC
GTGTCCCGGACCCTGAGGCCAGAATGAGTGAAGAAGCATGCCGAACCCGCAGTCAGAAGCGCACCCTTGAACCTGACCTA
ACGGAGGATGATGTGGAGAACAAAAAAAAAAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTTATTAAAAAAAAAG
CGGNTTCCGGTTTGACCTGCATGCNTGGTGCCNCCGGCGACGTCGTGTTGCTGGGAACCACCACTCCTCAGCTGGAAGAG
TTCTACTTCGAGCTGACCCGCAAAATGAACAACGACTTAGGGTGGTTCCGGTTCCAACCTGCGTACCCCCGCTTCCTGTC
TGGGCGACTCCCGCTGTGAATGGGCCTGCTACGACACCCAGGAGCTGTGCTACCAGATGACCCAGGAATACCAGGACGAA
CTGCACCGTCCGGTTTTCCCCTACAAGTTCAAATTCAAGTTTGATGGTTGTCCGAATGGTTGCGTGGTCTCCATTGCTCG
TTCCGACATGTCCTTCATCGGTACTTGGCGCGACAACTTCCGCATCGATCAGGAGGCCGTTGCCGCTTATGTCGGTGGC
Sequence Type mRNA
Unitrap ID UNI26142

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 71211598..72474652 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]

 
Come back to gene ENSMUSG00000036180


For any suggestions or comments, please send an email to unitrap@crg.es