Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_516H11-3
Clone ID CMHD-GT_516H11-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_516H11-3
Sequence
GCGCTTCATCCTTGTGTTCCTGCAGATCATCTGCGATGGGGAACGCGACGAGAACCACCCCAACCTCATCCGAGTCAACG
CCAACAAGGCCTATGAGATGGCCCTGAAGAAGTACCATGGCTGGCTGGTGCAGAAGATCTTCAAGGCCGCCCTGTACGCA
GCACCTTACAAGTCCGACTTCCTCAAGGCACTCTCCAAGGGGCAGAACGTGACAGAGGAGGAGTGCCTGGAGAAGATCCG
CCTCTTCCTGGTCAACTACACGGCCACCATTGACGCCATCTACGACATGTACACCAAGATGAATGCGGAGCTTGACTACA
CAGTGTAGGCGCCCGGACACACAGCCCCATGTGGGCACCAGCAACCCCATCACTGTGAATCAAGCTGGAATCCCCCAGCT
CAGCCAGCCCAGCCTGGCCAGCCTGGGTCTGCAGGGGGCAGCCTTAGCTTGTTAGAGGTCTTTTGTTTTCTTGGTTTTTT
GTTGTCTTGGCCTATTCTAATGGAGCAATAAGCACCTTCCATTCACTCCTCGGCTCCCCAAGCTCAGCCGCCACCATCCT
TCCAGTGTGCTTAAAACCAATTAACGTTGCTAACTAACGTTGCTAACGTGGAGGAATTCCTAGGGTTTTGTCATTTCCTC
CCCTACCTAGCTCAGGAGGAACTCAGCTCAGGGGCGACATACACCTCACCCAGCAAAGAAGCCCGGCCCATCTGGCCCAG
GGGTGTCTTGGATGCTTGAAGGACAATGGAAGTTTGATTGGAAGTTCAGCGGGTGCCCTACTGTGGCCTCTGTTTAAAAG
GCAAGCTGGCAGGAGCCCCCCTCACGGGGCTCACACATCCATCTGGCATAACCAGCCCT
Sequence Type mRNA
Unitrap ID UNI37054

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 115119885..115124207 719
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011884 (Gltp) NM_019821 glycolipid transfer protein Gene [Source:MGI (curated);Acc:Gltp-001]

 
Come back to gene ENSMUSG00000011884


For any suggestions or comments, please send an email to unitrap@crg.es