Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_235D8-3
Clone ID CMHD-GT_235D8-3
Vector pGTNMDf
Project cmhd

Sequence tag CMHD-GT_235D8-3
Sequence
GGAAAATTTCCCTTTATGAAGCAGATTTAAACAATCAACTTGTTCAGGCCGGTTCTCCATTGCCTGTCTCATCGGACTCA
TCACCACTATATGCTGTGCCTTAGGCTTAGATCCGGCTGGAAAACACCACATGACTTTTCATTGGCAGATGTGCTACCTG
AACACTGAACAGTTCCTACCAGAACCTCTGCTGTGAGCAATCCGAAAGCTGGCCAATCTCCTCCAGGCTGGCCAGGATCC
AGCCCTTAGAGTAACTCAAGAGTTCCACCTGCTGTGTTATCTGGACTCCCACTAAGTGCAGCACTGTGCCTTCGGAGCAG
CACCAACAAGAATGTATCCCTTCATCCCTCCAGCTAGACTACTACCAGGATCTCCAGCACCCTTTCTTCCTTCTGGACCA
TCGTGTCCCCAACCCAGTGGTCCATATCCAGGCCCTGCTGTACGAGTCCCTGGCCCCACAAGGTCATATGTTTCAACAAA
TGTGCCCTTTCCAGAGCTACCTAGGCCAAATAGCGCACCCACAGATCCAGTTGGTCCTTTAGGTACACAGGGATCCATGT
CTTCTGGACCTTGGGCACCAGGAATGGGAGGGCAGCATCCTAATGTGCCATATCTATTTCCAGAGTCATCTCCCACTCCT
CCTCTTCCAGTGTCAGGAGCACCACCTGTTGCATGGGTCACAGTGCCACCGGGGGCCTGGGAACCACCAGCGCAGTATCC
TACTCCTGAAGCGTCATATCCCAGCCCAGGACTCCAGCCTTCCCCGAATAATCCTTACCCACTGCCGCCAGGACCTTCTG
CTGCTTCACCA
Sequence Type mRNA
Unitrap ID UNI17257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 146027903..146028713 811
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041775 (Mapk1ip1) NM_027115 mitogen-activated protein kinase 1 interacting protein 1 Gene [Source:MGI (curated);Acc:Mapk1ip1-001]

 
Come back to gene ENSMUSG00000041775


For any suggestions or comments, please send an email to unitrap@crg.es