Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_537A6-3
Clone ID CMHD-GT_537A6-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_537A6-3
Sequence
CTCTGAATTCTCAGCCTGCCTTAATTTGCTGTGGGACTGTCCAGGATTCCAGGGACTCACGGATCCTAGCCTGATAAAGT
CACTGAAGACTCTGCCTCAACCGGTCCTGGGTTGTTCTTCCAAGTCACCTCCTTAGACCCAGCGATGCAAGGCTTGTCCC
CCACAAGTGAACTCCAGCTCCTGAGATCTTCAGGGCTACTGCACGGGGAGTATAGGAGTCTGTCCTCGTCGCCTCCGTGA
TGTAGCATGCGGAGGGCTACAGGGGACTGCAACTGGCCACGGGGACTGCAAGGCCAGAGCTGCGTTCCTGGCTCCAACAG
CTGATAAGCCTGTCACCGATACCACATCCACAGTGAGACCTGTGTTGGCTTCTCGAGCCCTTCAGGAACACCCTCCCAAA
GATGTCCCGGAGGCCTGTGTGTATCATCTAAACTCTCTGTCCTCTGACCACATTCTTCGAAGCCTCACATTTGGGCTGAT
AACACTTGTGCCTGATCCCGGGGGTGCCTCTGAGGCCTCCGAAGTTCTCCTGCTTCTCGGCATCTCCAGGCCTCGTATGG
GAGACATCCCAGGGTGGGGCAGGGTGTTGCAGTAATAAATGGATGGATCTGG
Sequence Type mRNA
Unitrap ID UNI14695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25940561..25941642 506
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074274 (D930028M14Rik) RIKEN cDNA D930028M14 gene Gene [Source:MGI Symbol;Acc:MGI:3687343]

 
Come back to gene ENSMUSG00000074274


For any suggestions or comments, please send an email to unitrap@crg.es