Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_234F3-3
Clone ID CMHD-GT_234F3-3
Vector pGTNMDi
Project cmhd

Sequence tag CMHD-GT_234F3-3
Sequence
ATTCTGAGCAATCCCGTGGCTGTCTCAAGAGGGCATGCTGCTTATTGTGTGGTTTGCAGAATACAGGGCCCAAGCTGACC
AAAGAAGAGGAGGCAGCTCTGAGGCAGAAGTTCTCAGACACATCTGAGAAGCCCTTGTGGAGAACCGTCATGAACATCAA
TGCCGTCCTCCTCCTGGGTGTGGCTGTCTTTGTCCATGCCTATTTTGCCTGAACCCTGAAGGAAGCAGAAACTATTTGTA
CTGAGTTTTCTTTTATAAAGTTGGCTGTGTAACAAAGG
Sequence Type mRNA
Unitrap ID UNI32919

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75521367..75521644 278
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020226 (Slc5a4b) NP_075708 solute carrier family 5 (neutral amino acid transporters, system A), member 4b Gene [Source:MGI (curated);Acc:Slc5a4b-001]

 
Come back to gene ENSMUSG00000020226


For any suggestions or comments, please send an email to unitrap@crg.es