Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_519H12-3
Clone ID CMHD-GT_519H12-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_519H12-3
Sequence
GGCTCATCCGGGAGCCGCACCCCACCAAGATCCCAGTGATTATAGAGCGATACAAGGGGGAGAAGCAGCTGCCCGTCCTG
GACAAGACCAAGTTCCTGGTGCCTGACCACGTGAACATGAGCGAGCTCATCAAGATAATCAGACGGCGCTTGCAGCTCAA
TGCTAACCAAGCCTTCTTCCTCCTGGTGAATGGGCACAGCATGGTGAGTGTGTCCACTCCCATCTCCGAAGTGTACGAGA
GTGAGAGAGATGAAGACGGCTTCCTGTACATGGTTTATGCCTCGCAGGAGACATTCGGGACAGCAATGGCTGTGTAAGAC
TCCAACAAAGCCAATGGTTGTTAAGCCCTTACCAAGGCAAAAAGGGATGTTACCAGCGGACGCTGGACGGCTCACCACCC
ACAGATGAGAACGTAGGCACCCACATAGGGTATTAGGAACTGTTCATCAGCCAGAAACTGAGCTCCATGCAAGTGCACTC
AGCTTGGAAACTCGTCTAAACTAGGCTATTTTGTGTTCAAACTTTAGAAGTTAAAAATAAAATACTTTTTGCATCCT
Sequence Type mRNA
Unitrap ID UNI13223

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124117411..124120910 418
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031812 (Map1lc3b) NM_026160 microtubule-associated protein 1 light chain 3 beta Gene [Source:MGI Symbol;Acc:MGI:1914693]

 
Come back to gene ENSMUSG00000031812


For any suggestions or comments, please send an email to unitrap@crg.es