Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_543F4-3
Clone ID CMHD-GT_543F4-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_543F4-3
Sequence
CTTTTGCTGGAGTCATGCACTGCAACTGTAGGCCGAGTATCCAACGTTAACCATAACCAGCGGGTCATCGGCAAGGCAGG
AAGGAACCGCTGGCTGGGCAAGAGGCCTAACAGTGGGCTGTGGCAACGCAAGGGAGGCTGGGCCGGCCGAAAGATTCGGC
CACTACCACCCATGAAGAGTTATGTGAAGCTGCCCTCCGCTGCTGCCCAAAACTGATTGCCCTGGACTCTAATAAAATGT
CTCTTGTTTTT
Sequence Type mRNA
Unitrap ID UNI20551

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46786834..46787080 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002767 (Mrpl2) NM_025302 mitochondrial ribosomal protein L2 Gene [Source:MGI (curated);Acc:Mrpl2-001]

 
Come back to gene ENSMUSG00000002767


For any suggestions or comments, please send an email to unitrap@crg.es