Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_543A3-3
Clone ID CMHD-GT_543A3-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_543A3-3
Sequence
CTATTTGTGTTCTCTAGCCGGCATATATTTCACCAATAGCCTCCTTATTCGATGCCACCCTGTCAAGACAACCTCTTGCG
CTTCTAGCTACATCTATGTGTTTGACGCTTACCGTTCTCACAGGGTCCTTCTGTCAGGGTAATTCCTCAAATATCATCCC
TCCACCATTGAGTCCTGGGGCCTTAGATGTCAATGACAGCGTAGTTGACAATGTTTCCAGCCCTGAAACCATTGTTGTTT
TTAATGGCATGCAGGCCATGCCCCTGTACTTGTGGACTTGCACACAGGATAGGACATTCTCACAGCATCCGATGTGGTCA
CAGGGCTACTCATCAGGACCAGGAATGGGTCTCTTCGCTGCAGTCCTGGGAATGGGTCTTAAATGGCAGCTCTGTTTAGT
GTCTACATCAGTTTAACAAGCAGAAGGGGTTGAGAGAACTGACAAAATGATAAATAACAGGTTACCTGTTCAGAATGATG
GGGTCACTAAAGGCACCGACCACACACTAGCATCATAGTGCCTTTGTCTTTACCTCTGGGCTTGACTGGGCAGATGCCAG
CTAAAACTTCCTCACTGTCTTTTCTATTTGACATCTTTCATCTCCTTTCCTATAGGTGACAGCAAGAATACTTTATATAG
AACAAGGATATTTTTTTCAAGCCTGTTATTTTCTAAAATGATAGCACAAACTAGGACAACAGGATGATTTCAGGTTTTCT
ATATAATTTTATAAAGTGCTTTGGATATCCAAATAAATCACCTTTGTCTGAAT
Sequence Type mRNA
Unitrap ID UNI13347

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35971934..35972687 691
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022906 (Parp9) NM_030253 poly (ADP-ribose) polymerase family, member 9 Gene [Source:MGI (curated);Acc:Parp9-001]

 
Come back to gene ENSMUSG00000022906


For any suggestions or comments, please send an email to unitrap@crg.es