Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_543H9-3
Clone ID CMHD-GT_543H9-3
Vector GepNMDi3
Project cmhd

Sequence tag CMHD-GT_543H9-3
Sequence
GTATAAGTTCTCTGCTTGCAGCTCCAGGCGCTAAACAAACATGCTGAGGCGCCTCCCTACTGGGACAGAGACATGGGCTT
TGCGGAACGCATAAGCCAAATCAGCCCTGCTTTGGGTGCCTTCAAAAATAGAGAAAAGAAGCCTTCTTGTAGTGTTCTCT
GGGGATCCCTCATACCCCAGCCACAGCACAGTTTCCAGAGTCTGCAGCAGGGCAGGGCTCCTCCCTGTCCTCCATAAAGG
AAAAGATGGCTGTTGTCACCCTCACCTCCTATGTACTCCAGGGTCTATGGGGAGTTCTCTCCCCTCAGCGTTTCAATCTT
TCTGGGATCGTTTCCCTTGCATGCCTTTCCCTTCCACCTCCCCCTGCAGTTCCGTGGCAGCAGTTACCAACTTTCCTGAA
TGGATTCCTGGCCCCCTTCTCCCTCACTATCTGTTGGATGCCCTTTGGCTCCTTTCCTTTTTTTGGCAAAAACAGTCACT
GTCCTTATAAAAGATTTTTAAATTAATAAAATCAGTGGCCTTC
Sequence Type mRNA
Unitrap ID UNI11948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5364641..5365054 393
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024844 (Banf1) NP_035923 barrier to autointegration factor 1 Gene [Source:MGI Symbol;Acc:MGI:1346330]

 
Come back to gene ENSMUSG00000024844


For any suggestions or comments, please send an email to unitrap@crg.es