Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_243G11-3
Clone ID CMHD-GT_243G11-3
Vector pGTNMDf
Project cmhd

Sequence tag CMHD-GT_243G11-3
Sequence
ATCAATAACTCGATCCTATTACCGCAACTCAGTTGGAGGATTTTTAGTGTTTGACATTACTAACCGACGGTCTTTTGAAC
ATGTGAAAGATTGGCTAGAAGAAGCAAAAATGCATGTAACAGCCTTTTCAGATTGTATTTCTACTGGTGGGACATAAATG
TGACCTGGCTTCGCAACGCCAGGTTTCAAGGGAAGAAGCTGAAAGACTGTCAACAGACTGTGGAATGAAGTACATAGAGA
CCTCAGCCAAGGACGCGACAAACGTTGAAGAGTCCTTTACAATCCTGACAAGAGACATATATGAGCTTATCAAAAAAAGG
AGAGATTTGAACTCTGCGTTGTTACCACTGCTTACGCGTAATTAACTAGAATTTGTGGTCTATTTCTGCTTCCGCGTGAG
TCACAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI27998

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 53494510..53494841 322
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055069 (Rab39) NM_175562 RAB39, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab39-001]

 
Come back to gene ENSMUSG00000055069


For any suggestions or comments, please send an email to unitrap@crg.es