Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_244A9-3
Clone ID CMHD-GT_244A9-3
Vector pNMDi2
Project cmhd

Sequence tag CMHD-GT_244A9-3
Sequence
AACCACGTCACTGCCTTTGCGGAAGTCACATGATGTTGAAGCAGACGGTTTTTCCCTGCACTGGACATCATCCCTATTTA
CCATACATTCATAACAGAGTTTATTTGATTACACAGGAAATTTATAAAGATGTAGGACACTTTTTATAATTTTAAAACTT
GACAGCACCCTCTCTGCCCCGCCCTCCCACGAGACTGTGAGCTCCTCAAGAGCAGGACCATGGCTTCCTCTTCTGCATCC
CCGCCACCCACGACAAAGCCCAGCACAAAGTGTGGGTGTTCAGTGAAAACACGATGATAAAACGAACAAGTCAACTCTTA
AATAAAATGGTTGCTTTAGTTTCTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTCCCCTTTAAAA
AAAAAAGANGCCCTCTATTTTGGGCTAGTTAAGTCTTTTTAATTTTTCATATATCTATTCAGCAGTATAGCATATTTAAT
TTGAAGTGAATTTTGAAAGTTCTGGGGACTTTTTATTATGCAGCATGACATTATTTCCATTTTAACAGATTTCAGTGTGT
GGAATCACTTTACTTTTAGAAAGTATGTCCTATACTAAATTGTTTGCTCATTATATTATGCTATATTTCACTTAAAACAC
CATTCATACTACATATTCTAAGACTGGTGCTTCTGCTTTTAAAGGGGAAAAGGCCAATTTTTACT
Sequence Type mRNA
Unitrap ID UNI37078

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 117389534..117390237 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033342 (4833424O15Rik) NM_029425 RIKEN cDNA 4833424O15 gene Gene [Source:MGI Symbol;Acc:MGI:1923019]

 
Come back to gene ENSMUSG00000033342


For any suggestions or comments, please send an email to unitrap@crg.es