Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_507H11-3
Clone ID CMHD-GT_507H11-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_507H11-3
Sequence
TTACCAACTGGGTGGCCCCCAGCTCCGTGTATTTCGAACTAACTTCTTCATTCAGCTGGTGCGGCCTGGTACTGCACAGC
CTGAAGATACCGTGCAGTTCCGGATCCCCATGGAGATGACCAGGGTGGACCTTCGGAATTACCTTGAGCAGATTTACAAT
GTTCCCGTGGCTGCCGTGCGCACACGGGTGCAGCATGGCTCCAACAGGAGGAGGGATCACAAGAATGTGAGGATCAAGAA
ACCAGACTACAAAGTGGCCTACGTGCAGCTGGCCCATGGGCAGACCTTCACTTTCCCAGATCTTTTTCCAGAGAAGGACC
CCCGTTCTCCAGAACCTCTGGAAGAGGAGCTACCCCAGCAGAGGCAAAGCAGCGACCTGAGGTGCCCTGGTATCCCTTCC
TGGTTTGGCCTATGACCTATGACAGCAGGATTTGGACCACAGACCCTAGTGAGCACAGTGGTTCTGACAAGCCCAAATAA
AAATTCTTTGTGGAG
Sequence Type mRNA
Unitrap ID UNI24210

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 149720919..149726647 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037772 (Mrpl23) NM_011288 mitochondrial ribosomal protein L23 Gene [Source:MGI (curated);Acc:Mrpl23-001]

 
Come back to gene ENSMUSG00000037772


For any suggestions or comments, please send an email to unitrap@crg.es