Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_507G2-3
Clone ID CMHD-GT_507G2-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_507G2-3
Sequence
TTGCAGGGTTCGATGACCTCTTTTTGTGTGCTGACCCTTGCGTCCCACCAGAATGGCTTCAGGACCCCAGGCAGGAAGAG
TTTTCTTCTAAAGCTCAGTAACCCGATTTCACTGCCAAGACGGATTCAGGCTGAAGGGCTCTACAAAGAGGCTGTGTATG
AAACATTTTAATGGGACCCTAGGCTGGGTCCCAAGTGACAAACCTGTCTGCATACAAGAAGACTGCCGCATCCCCCAAAT
TGAAGATGCTGAGATTCGAAACAAGACGTACAGACACGGAGAGAAGTTAGTCATTGACTGTCACGAGGGGTTCAAGATCC
GCTACCCTGACCTGTACAACCTGGTTTCGTTATGCCGTGACGATGGGACATGGGATAACCTGCCCATCTGTCAAGGCTGC
CTGAGACCTCTAGCCTCTTCCAATGGCTACGTGAACATCTCCGAGTTCCAGACCTCCTTCCCTGTGGGAACTGTGATCGC
CTATCGCTGCTTCCCTGGATTTAAACTCGAGGGTTCCGAGAACCTCGAGTGCTTACACAACCTTATCTGGTCGTCCAGCC
CACCCCGGTGCCTTGCTCTGGAAGGTAACACATATAAGCCTTTTGGATGGGGAGAGTCTGATGATGGCCAGAAGGGACTT
TTGCTTGCTGAAGCCCAGGTCACCCACCTGACCTGGAGCTATACTTATGTTAAACACACCCCCTCCCCCCACCCACCTGT
CACCATTCTTAGGGGGAAGAAGGCAAATAAAAGAAAAAGCCGAAAGAAAC
Sequence Type mRNA
Unitrap ID UNI37087

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 184763189..184788925 375
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038576 (Susd4) NM_144796 sushi domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2138351]

 
Come back to gene ENSMUSG00000038576


For any suggestions or comments, please send an email to unitrap@crg.es