Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_511H12-3
Clone ID CMHD-GT_511H12-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_511H12-3
Sequence
ATCTGTGTGGACGCCCGGACCACCTAATGCACGATGATGCTGGGAGCAGAAGGCGGAGAGGGCTTCATGGTGAAGGTCCG
GGGCTTGCCCTGGTCCTGCTCCGCGGATGAAGTGCAGCGCTTTTTTTCTGACTGCAAAATTCAAAATGGGGCTCAAGGTA
TTCCTTTCATCTACACCATATAAGGCAGACCAAGTGGCGAGGCTTTTGTTGAACTTGAATCAAAAGATGAAGTCAAATTG
GCCTTGAAAAAAGACAGAGAAACTATGGGACACAGATATGTTGAAGTATTCAAGTCAAACAACGTTGAAATGGATTGGGT
GTTGAAGCATACTGGTCCAAATAGTCCTGACACAGCCAATGATGGCTTTGTACGGCTTAGAGGACTCCCTTTTGGATGTA
GCAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATCGTGCCAAATGGGATAACATTGCCGGTGGACTTCCAGGGG
AGGAGTACGGGGGAGGCCTTCGTGCAGTTTGCTTCACAGGAAATAGCTGAAAAGGCTCTAAAGAAACAC
Sequence Type mRNA
Unitrap ID UNI37090

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50191800..50195079 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007850 (Hnrph1) NM_021510 heterogeneous nuclear ribonucleoprotein H1 Gene [Source:MGI (curated);Acc:Hnrph1-005]

 
Come back to gene ENSMUSG00000007850


For any suggestions or comments, please send an email to unitrap@crg.es