Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_242G4-3
Clone ID CMHD-GT_242G4-3
Vector pGTNMDf
Project cmhd

Sequence tag CMHD-GT_242G4-3
Sequence
GTGGTGAAGCAGTATTTTCCAATTTGAAGATTCATTTGAAGGTGGCTCCTGCCACCTGCTAATAGCAGTTCAAACTAAAT
TTTTTCTATCAAGTTCCTGAATGGAAGTATGACGTTGGGTCCCTCTGAAGTTTAATTCTGAGTTCTCATTAAAAGAATTT
GCTTTCATTGTATAAATACAAAAAAAAAAAAAAAGTGGTTTACGAATCCTGGCCTTCTAATGCAACCAGTTTGGGAGGCA
GGAGCCAGGAAGTAATCAAGAAATCAAGGAGTTTGCAGCCGGCTACAACGTCAAGTTTGACATGTACAGCAAGATCTGTG
TAAATGGGGACGATGCCCACCCACTGTGGAAATGGATGAAAGTCCAGCCCAAGGGCAGGGGCATGCTGGGAAATGCCATC
AAATGGAACTTTACCAAGTTTCTCATTGATAAGAACGGCTGCGTGGTGAAGCGCTATGGTCCCATGGAGGAGCCCCAGGT
GATAGAGAAGGACCTGCCGTGCTATCTCTAGCTAGCCCTACAAGTGTGTGCCCCTACACCGAGCCCCCCTGCCCTGTGAC
CCCTGGAGCCTTCCACCCCGGCACTCATGAAGGTCTGCCTGAAAACCAGCCTGCTGGTGGGGCAGTCCTGAGGACCTGGC
GTGCATCCCTGCCGGAGGAAGGTCCAGAGGCCTGTGGCCCTGGGCTCGAGCTTCACCCTGGCTGCCTTGTGGGAATAAAA
TGTAGAAATG
Sequence Type mRNA
Unitrap ID UNI12783

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 45595335..45595870 528
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078449 (AC153368.5)  

 
Come back to gene ENSMUSG00000078449


For any suggestions or comments, please send an email to unitrap@crg.es