Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_242F6-3
Clone ID CMHD-GT_242F6-3
Vector pGTNMDf
Project cmhd

Sequence tag CMHD-GT_242F6-3
Sequence
TCAAGCAATTTGGAACACCTAAGCCTTGACAGTACTGTAACATGATTGCAGCATTTATTGGTACCAAGTGTCAGCTTTGC
ACAAATTCAGAAAAGAAAAATGGAGCACATCAAAAATGTGAGCGGTGCATACTGCAGTGTGCTTTTGATCGCACGGAGGA
AGGAAAAATGAGAGTTGATGGAAAGTTGCTGTGCTGGCTCTGCACGCGTGTGGTACAGGAGAGTTTTACAAAAGACAAAT
TAGCAGAAGAAGAGTGTGGGGTCTTCACATTCTAACACCACATCTTCATCTCGTACTGAGAAAGACCAGCACCATTCTAA
ACACCACCACCACCACCACCATCACCATCACCGCCACAGCAGTGGCCACCACAAAGTCAGCAGTCTAAGTCCTGAGCAGG
AGCAGGGACTGTGGAAACAGAGCCATAAATCCTCTGCAGCAATTCAGAATGAAACTCCAAAGAAAAAA
Sequence Type mRNA
Unitrap ID UNI28334

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13634207..13640591 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037808 (2810485I05Rik) NM_176836 RIKEN cDNA 2810485I05 gene Gene [Source:MGI Symbol;Acc:MGI:1920076]

 
Come back to gene ENSMUSG00000037808


For any suggestions or comments, please send an email to unitrap@crg.es