Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_517B2-3
Clone ID CMHD-GT_517B2-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_517B2-3
Sequence
CTACAAGCCTGACCTGATCTGGTCCGACGGGGAGTGGGAGTGTCCTGACACGTACTGGAACTCCACCAGCTTCCTTGCTT
GGCTCTACAACGATAGCCCTGTCAAGGATGAGGTGATAGTGAATGACCGGTGGGGCCAGAACTGCTCCTGTCATCATGGA
GGGTACTACAACTGTCAAGACAAATACAAGCCACAGAGCTTGCCAGACCACAAGTGGGAGATGTGCACCAGCGTGGACAG
AGCGTCCTGGGGCTATCGAAAAGACATGACCATGTCGACCATCGCCAAGGAAAATGAAATCATCGAGGAATTGGTTCAGA
CGGTAAGTTTGGGAGGCAACTATCTTCTCAACATTGGACCAACTAAAGATGGCCTGATCGTCCCCATCTTCCAAGAAAGG
CTTCTTGCTGTCGGCAAGTGGCTGCAGATCAACGGGGAGGCCATCTATGCCTCCAAACCCTGGAGGGTGCAGTCGGAAAA
GGACAAGACGGTTGTGTGGTACACTTCTAAAAACGCAACTGTTTACGCCACTTTCCTGTACTGGCCAGAAAATGGGATCG
TGAACCTCAAATCCCCCAAAACGACCTCGGCCACAAAGATAACAATGCTAGGACTAGAAGGAGACCTGAGCTGGACCCAG
GATCCACTGGAGGGCGTCCTCATCTCTCTGCCACAGTTGCCACCTACCGTTCTGCCGGTGGAGTTTGCGTGGACTCTGAA
GCTGACAAAGGTGAACTGATCAAAGGAGCTCAAGGACAGACTGCCCGGGGCGCTGCTTACCATCCCTGCAATAAAGTAGC
TTCCCTTCCTTCC
Sequence Type mRNA
Unitrap ID UNI13757

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 135485814..135495203 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028673 (Fuca1) NM_024243 fucosidase, alpha-L- 1, tissue Gene [Source:MGI (curated);Acc:Fuca1-001]

 
Come back to gene ENSMUSG00000028673


For any suggestions or comments, please send an email to unitrap@crg.es