Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_519H10-3
Clone ID CMHD-GT_519H10-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_519H10-3
Sequence
TGTCCTGGCTTGTTCCTCCCCTTTTAAAGTTGACCTTATCATCTGGGAGATCGAGGTGCCAAAGCACTTAGTTGGTCGAC
TGATTGGCAAGCAGGGACGGTACGTGAGTTTTCTGAAGCAGACATCTGGTGCCAAGATCTACATCTCCACCCTGCCTTAC
ACACAGAACATCCAGATCTGCCACATAGAAGGCTCTCAGCACCATGTAGACAAAGATCTGAACTTAGATAGAGAAGAAGT
TTTGGGAACTGAACCTCACCAATATCTATGCGCCACCACTGCCTTCGCTGGCACTGCCTTCCTTGCCGATGACGTCTTGG
CTCATGCTACCTGATGGTATCACTGTGGAAGTCATCGTGGTCAACCAGGTCAATGCTGGGCACCTATTTGTCCAGCAGCA
CACACACCCCACCTTCCACGCACTGCGCAGTCTGGACCAGCAGATGTACCTCTGTTACTCTCAGCCTGGAATCCCCACCT
TGCCCACCCCAGTGGAAATCACGGTTATCTGCGCTGCCCCTGGTGCGGACGGGGCCTGGTGGAGAGCCCAAGTAGTGGCT
TCCTATGAGGAGACCAATGAGGTGGAGATTCGCTACGTGGACTATGGTGGATATAAGAGGGTGAAAGTCGACGTGCTCCG
GCAAATTAGGTCTGACTTTGT
Sequence Type mRNA
Unitrap ID UNI37094

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88696392..88702546 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018428 (Akap1) NM_009648 A kinase (PRKA) anchor protein 1 Gene [Source:MGI (curated);Acc:Akap1-002]

 
Come back to gene ENSMUSG00000018428


For any suggestions or comments, please send an email to unitrap@crg.es