Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_517F1-3
Clone ID CMHD-GT_517F1-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_517F1-3
Sequence
AACTTTGAGAATTTACCTCAGGAACTCTTCGCTGTTGACCCAACTACCATTTCACAGGGATTAAAAGATGACATTCTCTA
CAAATGCAGAAAATGCAGGCGGTCTTTATTTAGACATTCTAGTATTTTGGGTCATAGTGAAGGAAGTGGGCCAATAGCCT
TTGCTCACAAGAGAACGGCGCCGTCTTCTGTACTTACCACAGGGAGTCAGGCTCAGTGCACGTCTTACTTCATTGAGCCT
GTGCAGTGGATGGAATCTACTTTGTTGGGCGTTATGGATGGACAGCTTCTTTGCCCAAAATGCAGTGCCAAGTTGGGTTC
CTTTAACTGGTATGGTGAACAGTGCTCGTGTGGTCGATGGATAACCCCTGCTTTTCAAATACACAAGAACAGAGTGGATG
AAATGAAAATGTTGCCGGCGCTGGGTTCACAAACAAAGAAGCTGTGAACTTAAGACCCAGCTTGGGCTAGATCCTGTGAA
AGGCACTTCCCCGTTGTCATCATTCATGGCGGATGTCAAACTTCTTTTGGAATGTCCGAAGACAATTACTGACTGTAACA
GCTGTGGGTTGGTAGCTTATTATGTGGCATATATACAGTTACGTTGCTTGGCAATTCAGATATTTAGTTATGTAAGTTGG
ATTTGTTATTAAAATCTTTTATAACCC
Sequence Type mRNA
Unitrap ID UNI37097

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 172804320..172810357 369
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026659 (Dusp12) NM_023173 dual specificity phosphatase 12 Gene [Source:MGI Symbol;Acc:MGI:1890614]

 
Come back to gene ENSMUSG00000026659


For any suggestions or comments, please send an email to unitrap@crg.es