Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_517B6-3
Clone ID CMHD-GT_517B6-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_517B6-3
Sequence
CGGAGGGAGCGGACTGAGCAGCGTCACTGTCTTCAGAGTCCCTCATCAGGAAGAGAATGGCTGTGCGGACTTTTTTATCC
GTGGAGAGAGACTCAGAGACAAAAAGGTGGTTATTGGAATGTATGCTTAAGAAAGACCTCATCTATAATAAGGTCACTCC
CACATTTCACCACTGGAAGATCGATGACAAGAAGTTTGGCCTTACCTTTCAGAGTCCTGCTGATGCCAGGGCTTTTGATC
GAGGCATTCGAAGAGCTATAGAGGATATATCTCTAGGGTGCCCAGCGTCAAAAACTGAGGCTGAAGGAGGAGATGATGAT
TTACAAACGACTGAAGAAGACACTTCCCGTTCCCTAGTGAAAGATCACTTTTTCCAGCAAGAGACAGTTGTTACCAGTGA
ACCTTACAGAAGCTCAGACATAAGACCGTTACCCTTTGAAGATCTGAATGCCAGAAGAGTCTACTTGCAAAGCCAAGTCA
GCCAGATACCATTCAGTCAGCAAGGCCTAGACATTCAGAGCCGAAGTATGGAATATGTACAGCGGCGAATATCTAAGGAA
TGTGGGAGCCTAAAGTCCCAAACTAGGGTCCCTTTGAAGTCAATCAGACATGTCAGCTTTCAAAATGAGGATGAGATTGT
TAGAATAAATCCTCGAGATATCTTAATACGTCGATATGCAGACTACAGACATCCG
Sequence Type mRNA
Unitrap ID UNI14509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 116978797..117003145 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027351 (Spred1) NM_033524 sprouty protein with EVH-1 domain 1, related sequence Gene [Source:MGI (curated);Acc:Spred1-001]

 
Come back to gene ENSMUSG00000027351


For any suggestions or comments, please send an email to unitrap@crg.es