Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_545A1-3
Clone ID CMHD-GT_545A1-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_545A1-3
Sequence
GTTGCTACAAGATTACTACAGTTTTCAGCCATGCACAGACTGTGGTTCTTTGTGTGGGTTGTTCAACTGTGTTGTGCCAG
CCCACAGGAGGAAAAGCCAGGCTCACAGAAGGCTGTTCATTTAGAAGAAAGCAACACTAATGAGCTATGAAGTTCCGGAA
TTTGTGTTTTTCACAGAAAGCCTTACCAACTTCAGTTACTTTACCAAGACAATGTAATTATTGTTTGATTTTATAAAGTC
TACAACAATGATCTCCTATTTTGGTGTCAGTTTTTCAATAAAGTTTTAATTATGGAC
Sequence Type mRNA
Unitrap ID UNI14988

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 66795394..66797321 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036781 (Rps27l) NM_026467 ribosomal protein S27-like Gene [Source:MGI Symbol;Acc:MGI:1915191]

 
Come back to gene ENSMUSG00000036781


For any suggestions or comments, please send an email to unitrap@crg.es