Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST419361
Clone ID OST419361
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST419361
Sequence
GACCTGGAAGTTCATNTTTGNGCCGAAGANCAGTCAGAGAGCTGTTCTCTTCGTTGGTCTCTGTGACTCTGGGAAAACGT
TGCTGTTTGTCAGGTTGCTAACTGGCCAGTACAGAGACACACAGACTTCCATTACCGATAGTTCTGCCATATACAAAGTC
AACAATAACAGGGGTAACAGCCTGACTCTGATCGACCTCCCCGGGCATGAGAGCTTGAGGTTTCAGCTCTTAGATCGCTT
TAAGTCTTCAGCTAGGGCTGTGGTGTTTGTGGTGGACAGTGCGGCGTTCCAGCGGGAGGTGAAAGATGTGGCCGAATTTC
TGTACCAGGTCCTCATCGACAGCATGGCTCTGAAGAACTCACCGTCCTTATTAATAGCCTGCAATAAGCAAGATATCGCA
ATGGCAAAATCAGCGAAGTTGATCCAGCAGCAGCTTGAGAAGGAGCTCAACACCTTACGAGTCACCCGGTCCGCGGCTCC
CAGCACACTGGACAGTTCCAGCACCGCACCTGCTCAGTTGGGGAAGAAAGGCAAAGAA
Sequence Type mRNA
Unitrap ID UNI1880

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103092661..103103707 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032553 (Srprb) NM_009275 signal recognition particle receptor, B subunit Gene [Source:MGI Symbol;Acc:MGI:102964]

 
Come back to gene ENSMUSG00000032553


For any suggestions or comments, please send an email to unitrap@crg.es