Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone BA0470
Clone ID BA0470
Vector pGT2lxf
Project sanger

Sequence tag BA0470
Sequence
GGTTCCACCGCCGGCATGGCGCATTACAACTTCAAGAAGATTACGGTGGTGCCGTCTGCCAAG
Sequence Type mRNA
Unitrap ID UNI3556

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8995195..8995256 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021149 (Gtpbp4) NM_027000 GTP binding protein 4 Gene [Source:MGI Symbol;Acc:MGI:1916487]

 
Come back to gene ENSMUSG00000021149


For any suggestions or comments, please send an email to unitrap@crg.es