Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_534H12-3
Clone ID CMHD-GT_534H12-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_534H12-3
Sequence
TGGTATTGTCGAAGGCAAGGAGCCTTGAAAACTCTCCAGATATCCACATTGTGCAGGCAGGAAACCTTCACTCACTGACC
ATCGCCGAGGCCTTCGAAGAGGACACAGGACGATACTCATGCTTTGCTTCCAACATTTATGGGACAGATTCAACTTCCGC
TGAGATTTACATAGAAGGAGTCTCTTCCTCTGACTCAGAAGGGGACCCTAACAAAAAAAAGATGAATCGAATCCAGAAGC
CAAATGAGGTGTCCTCACCTCCCACCACCTCTGCAGCCATTCCTCCAGCAGCAGAAGCCCAGCCTTTGGCGGCCCAGCCC
AGAGTGTCCACCGTCCAGCAGGGACAAAAATCTACGTCGAGCACAAGTGACCGTGACCACCTTGCATGGCAGGGTCATGC
TCCTCGTGTGAAATCTATCATTAACATAATCACTGCGTCCGTCTGCTGCGAGAGCTCGTGGCTTCTGACAGCCTGGGGAA
CCTAGTCCCCAGCTCCTTGGGGAAACATCAGAAAAAAAAAAACACACGACCGGTAAATCCCCAACACCCTGGTTATATCA
CAAGCGACGGTCAAATGTGAACCAGAGGACCTCCATTTTTCCTTTCTTTCATGGAACTTGAAATGATTCTCCTTGCTAAT
ACAAGCAAAAGACGGTGGGTTTGTTGTTTTAGGAAAATA
Sequence Type mRNA
Unitrap ID UNI13763

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62625923..62632177 377
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020067 (Mypn) myopalladin Gene [Source:MGI Symbol;Acc:MGI:1916052]

 
Come back to gene ENSMUSG00000020067


For any suggestions or comments, please send an email to unitrap@crg.es