Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_534G5-3
Clone ID CMHD-GT_534G5-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_534G5-3
Sequence
CGCCGCAGCCCTGACCCTTACGCTGTTGCCAACTCTGGGCCACTCTGGCTGGCTACCAAGCGGCTCAAGATGTCTGCAGG
GGCCAGTGCTACAGGGCCCAGGAGGGGGCCGCCAGGACTGGAAGAGGCCACTAGTAAGAAGAAACAGAAGGATCGAGCAA
ACCTGGAAAGTAAAGATGGAGATGCTAGGAGAGTGTCCCTTCCTCGAAAGGAACCAACC
Sequence Type mRNA
Unitrap ID UNI25890

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108394869..108395324 187
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006676 (Usp19) NM_027804 ubiquitin specific peptidase 19 Gene [Source:MGI Symbol;Acc:MGI:1918722]

 
Come back to gene ENSMUSG00000006676


For any suggestions or comments, please send an email to unitrap@crg.es