Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_505F4-3
Clone ID CMHD-GT_505F4-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_505F4-3
Sequence
TTATAGGAGGCCTTAGCTGGGACACCACAAAGAAAGATCTGAAGGACTACTTTTCCAAATTTGGTGAAGTTGTAGACTGC
ACTCTGAAGTTAGATCCTATCACAGGGCGATCAAGGGGTTTTGGCTTTGTGCTATTTAAAGAGTCGGAGAGTGTAGATAA
GGTCATGGATCAGAAAGAACATAAATTGAATGGGAAAGTCATTGATCCCAAAAGGGCCAAAGCCATGGAAACAAAAGAGC
CTGTCAAAAAAATTTTTGTTGGTGGCCTTTCTCCAGACACACCTG
Sequence Type mRNA
Unitrap ID UNI21706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 100395079..100396398 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000568 (Hnrnpd) NM_007516 heterogeneous nuclear ribonucleoprotein D Gene [Source:MGI Symbol;Acc:MGI:101947]

 
Come back to gene ENSMUSG00000000568


For any suggestions or comments, please send an email to unitrap@crg.es