Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_505A4-3
Clone ID CMHD-GT_505A4-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_505A4-3
Sequence
TTGCAGGGTCTAACGAGAGCATCATTACCAACAGCAGGCAGATACGCCTTGCCACAGGCATCTTCCCTGTTGTCAGCCTC
CTGAACCACTCCTGCAGGCCCAACACCAGTGTGTCCTTCACTGGCACTGTCGCCACCGTCCGGGCAGCACAGAGGATCGC
AAAAGGACAGGAGATTCTGCACTGCTATGGGCCTCACGAGAGCCGGATGGGCGTTGCTGAGAGGCAGCAGAGGCTGAGTT
CTCAGTACTTCTTTGACTGCCGCTGTGGGGCCTGTCACGCTGAGACACTGAGAGCAGCTGCAGCTCCCAGATGGGAAGCC
TTCTGTTGTAAGACTTGCAGAGCGCTCATGCAGGTAAATCTCTGCTGTTCCCAGGGGCAGGGCTCCAGCTAAAGGTTGTC
AGTCGCGAAGAGAACCATTCCTGCTTCGCTTCATGTAACTCCTCCCGACATGTCGCCCGGTACTGCACAAAAAACAGGTT
GTATTTCCTAATATTTTCCCTATAAGTGACACAGAATCGGTAAGTTACACAAAGGGACCTGACAACAAAACAAAAAAAAA
AGAAAGAAATTGAAGATGGCCTGGCCCAAGCCCATGCTACCTTAGGGAACTGGCTAAAGTCTGCTGCCCATGTACAGAAG
AGTCTCCAGGTGGTTGAAACTCGCCATGGGCCATCCAGTGTTGAAATTGGCCATGAGCTCTTCAAACTGGCCCAAGTCCT
ATTCAATGGGTTGGCAGTGCCTGAAGCTCTGAGTGCCATCTGGAAGGCAGAAAGGATCCTGTTGGTGCACTGTGGCCCT
Sequence Type mRNA
Unitrap ID UNI20848

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75213097..75218337 336
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018809 (Smyd4) NP_001096081 SET and MYND domain containing 4 Gene [Source:MGI (curated);Acc:Smyd4-001]

 
Come back to gene ENSMUSG00000018809


For any suggestions or comments, please send an email to unitrap@crg.es