Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_505F7-3
Clone ID CMHD-GT_505F7-3
Vector UPA
Project cmhd

Sequence tag CMHD-GT_505F7-3
Sequence
TGGGAAGACAAGCCTCATAAGAAGAATTCAGGGCATAGAGGAGTACAAGAAGGGAAGAGGACTGGAGTACCTGTACTTAA
ATGTGCACGACGAAGACAGGGATGATCAAACAAGATGTAATGTATGGATCTTAGATGGAGATCTGTACCACAAAGGGCTA
CTCAAGTTCTCTCTGGATGCCCTTTCTCTGAGGGACACTCTGGTCATGTTGGTTGTTGATATGTCAAAGCCTTGGACTGC
TTTGGATTCCTTACAGAAATGGGCAAGTGTGGTGAGAGAACATGTCGACAAGCTGAAAATCCCCCCTGAAGAGATGAAGG
AAATGGAGCAGAAGTTGATTAGAGACTTCCAAGAGTACGTGGAGCCAGGAGAAGACTTCCCAGCCTCCCCTCAGCGAAGA
ACCACTGGTGCGCAGGAGGACAGAGGTGACAGTGTTGTCCTGCCCCTGGGTGCAGACACACTCACACACAACCTGGGCCT
ACCAGTGCTCGTAGTCTGTACGAAGTGTGATGCCATTAGTGTATTGGAGAAAGAGCATGACTACAGAGATGAACACTTCG
ATTTTATCCAGTCTCACATCCGCAAGTTCTGTTTACAGTATGGCGCAGCGCTGATTTACACTTCAGTAAAAAAAAACAAA
AACATAAACTTAGTTTATAACTACATCGTCCACATACTGTACGGGTTCCCGTACAAGATCCCTGCGGTGGTGGTGGAGAA
GGACGCAGTGTTTATTCCAGCAGGGTGGGATAATGAT
Sequence Type mRNA
Unitrap ID UNI5198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114614185..114624739 232
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032435 (Dync1li1) NM_146229 dynein cytoplasmic 1 light intermediate chain 1 Gene [Source:MGI Symbol;Acc:MGI:2135610]

 
Come back to gene ENSMUSG00000032435


For any suggestions or comments, please send an email to unitrap@crg.es