Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CMHD-GT_539D1-5S
Clone ID CMHD-GT_539D1-5S
Vector UPA
Project cmhd

SPLK-Sequence tag CMHD-GT_539D1-5S
Sequence
AATTTGGAAGAAGGAGTCCTAAATACAAATAAGAGATGGAATAAGTGAAGGATTGAAATGATAAGACTAAGAGAGGATAA
GAGGAGCTCTGTGTGTGTGTTTGTTTATTCCTGTGTGTCTGTGAACCTTTCTTAGTAAAGGAGAGCAACACATTGAGATC
CCCAAATGTGCACACGAACACTAGCTATGTTGTTTCAAATGCTGGTTGATCTTCCTTCTTTCTTTTCTAACCATGTCCTG
TCCCCTGACTACCTAAAGATGTTACTTTCACTTTGAGTCATTGTAATAGTCATTCATTATGCATTTTTCTTCATCATTAA
GGATATACCACTTTTGGAATAAAGCTTAAAACAAACAAACAAACCAACTAATCAGAAAGCCTGTATTGCAGGACTGGAGA
GATGGGTCAGTGATTATAAGTGTTTACTGCTCTTCTAGGGGGCACTGGTTCAGTTCCCAGCACCCACATAGTGGCTCATA
GCTGTCTGTAACTCCAGCTCCAAGAGGCAAACATACATACCTACAACCAGCCAACCAACCAGCCAACCAACC
Sequence Type genomic DNA
Unitrap ID UNI35992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18905670..18906221 552
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022702 (Hira) NM_010435 histone cell cycle regulation defective homolog A (S. cerevisiae) Gene [Source:MGI (curated);Acc:Hira-001]

 
Come back to gene ENSMUSG00000022702


For any suggestions or comments, please send an email to unitrap@crg.es